Conéctate a nuestras redes


Peter Frampton en Chile: Ganadores



Peter Frampton sigue siendo uno de los artistas y guitarristas más reconocidos de la historia del rock. Nacido en Londres, estudió en la Escuela Técnica de Bromley y fue compañero David Bowie (con quien más tarde grabó y giró). A los 16 años, fue cantante y guitarrista de la banda de adolescentes británicos, The Herd y más tarde de la reconocida Humble Pie. Su quinto álbum en solitario, “Frampton Comes Alive!”, es considerado uno de los mejores y más vendidos discos en vivo de todos los tiempos.

Sus seguidores tendrán la posibilidad de verlo en Chile de forma individual este próximo 4 de septiembre en el Teatro Caupolicán. El 2008 estuvo en el Festival de Viña, pero ahora vendrá a deleitar a sus seguidores con su último álbum titulado “Thank You Mr. Churchill” y sus mejores éxitos como “Baby, I love your way”, “Do You Feel Like We Do”, “Show Me The Way” o “I’m In You”, entre otras.

El inglés de 60 años dice estar mejor que nunca, “Tuve que hacer lo que era necesario para llegar a donde estoy ahora, pero a lo que me refiero es la claridad que tengo, disfrutar la creatividad es mucho mejor”, insistió el músico a un diario argentino.

Su nueva producción, “Thank You Mr. Churchill” su decimocuarto trabajo de estudio, fue lanzado en abril de este año y que incluye su primera colaboración con su hijo Julian. Contiene 11 temas coproducido por Frampton y lo muestran muy reflexivo con los temas de su entorno. “Este álbum es muy autobiográfico”, dijo Frampton. “Comienza con el nacimiento donde yo le agradezco a Mr. Churchill, haber traído a mi padre de vuelta de la Segunda Guerra Mundial”. Grabado en el estudio de su casa en Cincinnati, esta última placa tiene temas profundamente íntimos, tejiendo cuentos de la pérdida, el amor y la redención y la experiencia adquirida a lo largo del camino.

En HN tenemos invitaciones para sortear entre quienes dejen un comentario (abajo). Coloca tu nombre completo en el campo indicado, y un email válido de contacto.


Natalia Subiabre
Ignacio Alonso Araya Albornoz
Daniel Retamal
Rocio Ortiz Soto

Entradas ya a la venta a través de sistema Ticketmaster.

Valores: $18.000, $25.000, $40.000 y $60.000.

224 Comentarios


  1. Daniel Zaror

    25-Ago-2010 en 3:08 pm

    vamos que se puede, esta vez si quiero ganarme una entrada T_T

    • Luis Artus

      27-Ago-2010 en 9:57 pm

      Espero poder ganarme las entradas. Es uno de mis artistas favorito. Grande Peter

  2. Sebastian castillo

    25-Ago-2010 en 3:09 pm

    ohh maestro peter frampton en viña estuvo la raja y despues andaban pelando que fue demasiado largo, eso para quienes no estan acostumbrados a shows de calidad.
    que ganas de ir pero ya me gaste la poca plata que tenia en Rush!

  3. Mauricio

    25-Ago-2010 en 3:09 pm

    No lo pude ver la vez anterior. Quiero ir!!! Gracias Humo Negro por favor concedido.

  4. Juan Estay Ruggieri

    25-Ago-2010 en 3:09 pm

    Yo quiero una entrada, puede ser una oportunidad que no se repita otra vez 😀

  5. daniela perez

    25-Ago-2010 en 3:10 pm

    yo quieroo una invitacion!! 🙂 estaría muy agradecida

  6. Juan Pablo Salas Fernández

    25-Ago-2010 en 3:10 pm

    Yo quiero ir a ver a Peter Frampton !!!!! , bueno también quiero ir a ver a El Cruce de lujo y a Pennywise …. mmm. Bueno la idea es esa …. jajajajaj
    Saludos !.

  7. Janina Aguilera Lara

    25-Ago-2010 en 3:11 pm

    Ojalá pueda ganar entradas… En estos tiempos donde todos los días despiertas y te preguntas si los grandes músicos de la historia aún viven, estas oportunidades son incomparables.

    • Marialicia

      31-Ago-2010 en 3:22 pm

      Toda la razón ! Yo aún espero a los Rolling Stones, ojalá vengan antes de que sea demasiado tarde.

  8. Juan Alarcón R.

    25-Ago-2010 en 3:12 pm

    ufffff!!! tremendos conciertos que se acercan, lastima que no alcanza la $$$ para ir a todos… PORFA UNA ENTRADA PARA EL POBRE JUAN!!!!

  9. hernan acosta

    25-Ago-2010 en 3:13 pm

    saludos ,bna pagina y obvio que quiero una entradita pa ver al maestro .

  10. Anna Harkko

    25-Ago-2010 en 3:13 pm

    Show me the way para ganar esa entradita.

  11. Marcos Alvial

    25-Ago-2010 en 3:13 pm

    Ahora si, tengo que ganar una invitación…

  12. Fernando Navea Bravo

    25-Ago-2010 en 3:13 pm

    grande frampton. un maestro de la guitarra. ojalá pueda ganar una entrada para ver a este grande

  13. felipe rodriguez santa maria

    25-Ago-2010 en 3:13 pm

    yo quiero una entrada para ver a frampton!, la ultima vez que vino no pude verlo y mori!!, creo que no se puede morir 2 veces asi que porfaaa una para mi!!!

  14. Gabriel Ignacio Braukmann

    25-Ago-2010 en 3:13 pm

    pye ya mande para anthrax locoo xD pero si me llega cualquiera de estas bkn wm la wea es pasarla bkn disfrutar de un buen rock con Frampton quien no lo pasa bien asi que a disfrutar del rock y la entrada tiene que ser mia po Humor Negro xD

  15. pedro villalobos

    25-Ago-2010 en 3:13 pm

    una entradits por favor. quiero ir y cantar wawawawawa wawawawawa waa

  16. Maria Fernanda Baeza

    25-Ago-2010 en 3:13 pm

    EE !!! yo quiero una !!!

  17. Baltazar Sanchez Escobar

    25-Ago-2010 en 3:14 pm

    yo kiero sx entrada pa ver al maestro…

  18. Claudio andres Leiva Lopez

    25-Ago-2010 en 3:14 pm

    lejos el mejor año musical de chile, TODOS LOS GRANDES ARTISTAS VIENEN VENDRAN O VINIERON!!!!!!! +100000000000 pal bisentenario de chile y su gran cantidad de artistas

  19. mario troncoso M

    25-Ago-2010 en 3:15 pm

    ahora si q si espero ganarme la entrada!!! saludo

  20. Carlos Guerrero Munita

    25-Ago-2010 en 3:22 pm

    Quiero ver al seco de Peter!!!

  21. Angelina Zuñiga

    25-Ago-2010 en 3:23 pm

    yo quiero una entrada!

  22. Alfonso Muñoz Sahr

    25-Ago-2010 en 3:27 pm

    Show me the way !!!!! YO QUIERO

  23. Mauricio Gajardo

    25-Ago-2010 en 3:36 pm

    Yo también quiero una! xD salu2

  24. Maria Guerrero Gajardo

    25-Ago-2010 en 3:38 pm

    es mi amor platónico…lo unico que quiero es verlo nuevamente!!! una entrada por aqui pliiis

  25. Juan Carrasco

    25-Ago-2010 en 3:44 pm

    Creo que fue mi primer disco en vivo el Framptom Comes Alive y no pude ir cuando vino a Viña, asi que si es que no voy ahora lo mas probable es que este muy viejo y no venga, jajaj saludos.

  26. nicolas faundes

    25-Ago-2010 en 3:53 pm

    o.o q bkn me gutaria demasiado ir pero el bolsillo no aguanta tantos evnetos pueden ayudarme con entrada plis ??? 🙂

  27. Fabrizzio Dagnino

    25-Ago-2010 en 3:54 pm

    Tremendo Frampton y sus cover grunge !!!

    • patricia

      28-Ago-2010 en 11:58 pm

      peters es un artista de gran calidad me encanta

  28. Pablo Moya Astorga

    25-Ago-2010 en 3:55 pm

    Me encantaría escuchar hablar la guitarra de Frampton, debe ser genial. Ayer veía “Casi Famosos” y caché que Frampton hace un cameo, como manager de Humble Pie, jajaja. Después me fui a google a investigar y claro, era él; y además de eso, asesoró al actor que hace de Russel Hammond con la guitarra, y en la película el personaje dice “Quién podría pedir un mejor profesor que Peter Frampton?”. NOTABLE

    Bueh, por esto mismo me gustaría ir, para poder sentir aunque sea hora y media la mística de los ’70. Sería excelente.

  29. Sebastian Mella S.

    25-Ago-2010 en 4:05 pm

    Wow peter Frampton la lleva, es un grande de la musica. Me gustaria mucho verlo en vivo ^^ saludos HN

  30. juan Angulo

    25-Ago-2010 en 4:08 pm

    excelente quiero irrrr

  31. Ivan

    25-Ago-2010 en 4:11 pm

    Yooooo quieroo para regalar!! mi vieja es fanatica de Frampton y esta de cumple hoy!! ojala sean dos para que vaya con mi viejo 😀

  32. Joaquín Cruzat Palacios

    25-Ago-2010 en 4:21 pm

    Yo quiero una porfavor!!!!

  33. Daniel Neira Bravo

    25-Ago-2010 en 4:24 pm

    A ver si me gano esta entrada…

  34. Eduardo Díaz Fredes

    25-Ago-2010 en 4:32 pm

    Esta vez si que me las gano!!!

  35. Claudio Hidalgo Neira

    25-Ago-2010 en 4:35 pm

    grande Peter Frampton! ojalá pueda ir a ver al maestro!

  36. Miguel Caroca

    25-Ago-2010 en 4:36 pm

    Tremendo artista, ahora solo se podra apreciar mejor su calidad musical, saludos y gracias por el concurso

  37. cristian blas

    25-Ago-2010 en 4:38 pm

    Los años no pasan y Peter Frampton nos mostrara el camino del rock, este año no da para mas pero gracias por el concurso, un auspicio para asistir es necesario
    suerte a todos

  38. jose molina

    25-Ago-2010 en 4:38 pm

    Chiquillos quiero ir con mi vieja!!!!!! esta de cumple justyo ese dia

  39. Sebastián Valenzuela

    25-Ago-2010 en 4:44 pm

    A ver si alguna vez gano algo en la vida! Aguante Frampton! Cuaaaaaa… cuacuaucacuacuaaaaaaaaa!!

  40. matias

    25-Ago-2010 en 4:52 pm

    vamos a por una

  41. Carla

    25-Ago-2010 en 4:57 pm

    Definitivamente quiero ir.. aparte.. sería genial invitar a mi papa a verlo.. pq hay q agradecer a quienes nos inculcaron la buena música =D

  42. pablo carrasco

    25-Ago-2010 en 5:08 pm

    Me encantaría ir a escuchar a Frampton! un clásico, un grande, un ídolo. Si no me gano una entrada, no habrá otra posibilidad de ir, así de lapidario.

  43. luis felipe palma guerrero

    25-Ago-2010 en 5:14 pm

    una entarda aqui pos amigos de humo negro
    que el bolsillo ya no aguanta =)))

  44. Guillermo Pereira M.

    25-Ago-2010 en 5:21 pm

    Yo quiero unaaaaaaaaaaa!!!!!!!!!!!!!!!! 🙂

  45. Diego San Martín

    25-Ago-2010 en 5:24 pm

    Vamos que me gano una !!!!! :D:D:D
    ya que no fui a viña acá por ultimo hahaha saludos!

  46. Mauricio Prado

    25-Ago-2010 en 5:37 pm

    yo quiero pa ir con mi viejo !


    25-Ago-2010 en 5:54 pm

    46 años y Peter es de mi epoca


    25-Ago-2010 en 5:56 pm



  49. sebastian flores palma

    25-Ago-2010 en 6:08 pm

    meresco la oportunidad de ver al maestro frampton necesito ese ticket

  50. Dominique Ravet

    25-Ago-2010 en 6:19 pm

    quiero ganarme la entrada porfaaa!! osino me quedo sin ir a niun concierto de este año =(

  51. Felipe Carrasco Guzmán

    25-Ago-2010 en 6:35 pm

    Mas que merecerme “yo” esaq entrada la verdad es que lo hago por mi viejo. rockero a cagar en los 70’siempre se ha sacado la mierda por nosotros y gracias a el y todo su esfuerzo es que me encuentro estudiando. dinero no tengo niuno como para poder regalarle una entrada. y como es de terco jamas se comprara una ya que las lucas no sobran, al contrario, ademas que se encuentra preocupadisimo por un drama que tengo en el instituto. y eso
    espero ser el afortunado, bueno. mas que yo, mi viejo. y puta si no es asi no importa. ojala si la gane alguien que de verdad se lo meresca.

    saludos Humo Negro!

  52. Felipe Carrasco Guzmán

    25-Ago-2010 en 6:37 pm

    lo olvidaba. mail valido de contacto porsi

  53. josé alvear

    25-Ago-2010 en 6:45 pm

    De chico fue el primer disco en vivode rock que escuché junto con el de Neil Diamond. Feliz iría

  54. Alejandro Arístegui

    25-Ago-2010 en 7:01 pm

    Sería el regalo perfecto para mi viejo.

  55. Matías Infante Brunet

    25-Ago-2010 en 7:12 pm

    Simplemente un gran guitarrista con unas excelentes canciones, que mejor escuchar algo de Humblepie (stone cold fever) o solista (lines on my face).

    Ojala pueda corear el Do you feel like we do!!!

  56. ana cautivo

    25-Ago-2010 en 7:45 pm

    yo tambien kiero ir, me trae recuerdos aquellos temas

  57. Sebastián Castillo

    25-Ago-2010 en 8:24 pm

    yo quierooooo, me fui a perdida y no tengo ni uno para los conciertos que vienen T.T

  58. Marcelo Moya

    25-Ago-2010 en 8:46 pm

    Show me some tickets!

  59. Sebastián Geiger Prat

    25-Ago-2010 en 9:09 pm

    Tremendo guitarrista! Humo negro… entralizame!

  60. Same Sapag

    25-Ago-2010 en 10:03 pm

    Grande Humo Negro, siempre se agradecen estos sorteos.

  61. Luciano Silva

    25-Ago-2010 en 10:07 pm

    Que grande Frampton. Ojalá me gane las entraditas ya que me lo gaste todo en los demas grandes conciertos que vienen

  62. Pablo Ignacio Muñoz Vallejos

    25-Ago-2010 en 11:02 pm

    Yo quiero una entrada, Grande Peter

  63. Solange Ramirez

    25-Ago-2010 en 11:03 pm

    me encantaría ganarme una entradita 😛 grande Framptom

  64. Abel Silva

    25-Ago-2010 en 11:21 pm

    un artista de peso, que ha mantenido su calidad musical a pesar del largo paso de los años

    una entradita por aqui!!!

  65. valeria muñoz

    25-Ago-2010 en 11:25 pm

    que guachon se ve asi de viejo peter frampton…como no ir a verlo ademas que su musica es increible ojala me gane una entrada!!

  66. Juan Avalos Martinez

    25-Ago-2010 en 11:29 pm

    simplemente un idolo del rock

  67. Ignacio Larrain

    25-Ago-2010 en 11:49 pm

    Grande Peter!

  68. Jose Landabur

    25-Ago-2010 en 11:53 pm

    Como no verlo si el mismo dice que esta en sus mejores tiempos!

  69. eric martinez

    26-Ago-2010 en 12:11 am

    Quiero iiiiiiiiiiiiiiiiiiiiiir¡¡¡¡¡¡¡¡¡¡¡¡
    Especial para compartir una noche de buena musica junto a mi viejo.
    grande framptom…………….

  70. Eduardo Vergara

    26-Ago-2010 en 1:06 am

    Quierooo iiir !!!
    Tremendo musico !

  71. Carolina Isabel Casanueva Reyes

    26-Ago-2010 en 1:27 am

    Excelente Peter Frampton, quiero una entrada please!!

  72. Hugo González Peters

    26-Ago-2010 en 3:30 am

    HumoNegro: Show Me The way!

  73. Rene Sottolichio R.

    26-Ago-2010 en 9:09 am

    Tremendo clásico, ojala me gane entradas.

  74. Lino Pastene

    26-Ago-2010 en 9:22 am

    Porfa una entrada para mi, septiembre y octubre viene salado.


    26-Ago-2010 en 9:22 am

    cuando dice “tenemos invitaciones” deberian ser sus 10 de una y no menos..

    anotenme condenaos!..

  76. David Meneses Bustamante

    26-Ago-2010 en 9:32 am

    Hola muchachos, es genial que regalen entradas, me encantaría ir al recital de Peter Frampton. Un abrazo.

    • Flor Espinoza González

      26-Ago-2010 en 9:55 am

      Peter Frampton, escuchar en vivo las canciones que se bailaban a la 1 de la mañana, cuando en las fiestas ochenteras se permitia colocar los blues, e incluso en una canturreada fogata cerca de la playa.


        26-Ago-2010 en 10:30 am

        de estudio ya suena bien, en vivo es excelentemente..

  77. Natalia Fuenzalida A.

    26-Ago-2010 en 10:38 am

    Peter Frampton es demasiado imperdible. Encuentro genial que regalen entradas pero más genial sería que me regalaran una entrada a mi.

    Saludos. Excelente pàgina!

  78. Gonzalo Layseca A.

    26-Ago-2010 en 11:05 am

    Notable Frampton!!! El hombre que hizo cantar a la guitarra!!! A ver si nos ganamos alguna invitación para ir.


  79. Camilo Valdivieso G.

    26-Ago-2010 en 11:15 am

    Aguante Frampton, una de las figuras emblemáticas del rock y maestro con la guitarra!!!!
    Ojala gane las entradas para ir a verlo!

  80. Nacho

    26-Ago-2010 en 11:36 am

    Un capo 🙂 Que ganas de poder ir a verlo
    Saludos HumoNegro

  81. Mario Vega

    26-Ago-2010 en 12:04 pm

    woooo… grande quiero una entrada

  82. Margaret Greenhill

    26-Ago-2010 en 12:49 pm

    Que ganas de ir a verlo y corear ….. i want you show me the way!!!!!

  83. Lucas Araya A

    26-Ago-2010 en 1:00 pm

    la guitarra de frampton iluminó varios veranos mientras viajábamos en el auto de mi viejo al norte o la playa. lindos recuerdos de mi primera impresión de un solo de guitarra.


  84. Eduardo Olivares Abell

    26-Ago-2010 en 1:25 pm

    Frampton!!! Idolo!!! Maestro iluminador de muchos!!!

  85. René Olivares Zamora

    26-Ago-2010 en 2:06 pm

    Grande Peter Frampton, el Frampton Comes Alive debe estar entre los mejores de la historia.
    Quiero ganarme una entrada para este concierto, ya que con los precios que pagué para Lionel Richie, Scorpions, Bon Jovi, Rush, ya parezco naturista en playa La Luna de Horcón, o sea, estoy EMPELOTA, sin contar los otros eventos rockeros que se vienen, asi que sres. de HN tengan un poco de misericordia con este humilde servidor rockero. Gracias.

  86. Felipe Choapa

    26-Ago-2010 en 2:25 pm

    Que leyenda del BLUES loco!
    Quiero puro ir!

  87. Juan Ignacio Silva

    26-Ago-2010 en 3:02 pm

    yo quiero unaaa, framptom la lleva !!

  88. Cristian Enrique Perez Avendaño

    26-Ago-2010 en 3:57 pm

    Imperdible wn!!! Imperdible!!!

  89. MAriano Bustos

    26-Ago-2010 en 3:59 pm

    Vamos mierda a aganar!

  90. Juan Ignacio Aguilera

    26-Ago-2010 en 4:33 pm

    una entradiiitaaa

  91. Ana Maria

    26-Ago-2010 en 5:04 pm

    Uhhhh, Peter Frampton clasicazo! Me encantaria ganarme una entradita, saludos chicos!

  92. claudio romero

    26-Ago-2010 en 5:24 pm

    vamos por una entrada !!!

  93. David Silva Castro

    26-Ago-2010 en 5:28 pm

    kiero ir!

  94. Felipe Riquelme

    26-Ago-2010 en 6:09 pm

    Quiero ir!

  95. jose david aros duran

    26-Ago-2010 en 6:31 pm

    sin quiero estar presente en ese concierto Peter Frampton es la banda sonora de mi vida . porfissssssssssssss . suerte para quien gane.

  96. Alvaro Pimentel

    26-Ago-2010 en 8:04 pm

    Excelente!! que ganas de ir a ver a este grande! pero el bolsillo no me lo permitee ocn tanto wen grupo en caminoo

  97. César Issa Ortiz

    26-Ago-2010 en 8:42 pm

    Que gran maestro y guitarrista que en sus comienzos tocara en “Humble Pie” junto al desaparecido y gran vocalista “Steve Marriot”, recuerdo ese gran tema “I don’t need no doctor”, chuta y despues, tantos grandes temas como “Do you feel like we do” y tantos otros, bueno compre la entrada para “Rush” y no me alcanza para “Peter” pero bueno igual les dejo el enlace con los Humble Pie cuando era joven con el gran Steve Marriot, bueno si me gano las entradas bacan sino el que se las gane que disfrute de esta leyenda de la Guitarra y del Rock.

  98. Claudia Zapata

    26-Ago-2010 en 8:50 pm

    Yo kiero ir!!!!!!!!!!!!

  99. Bea

    26-Ago-2010 en 9:46 pm

    bkn!! me gusta yo kiero una porfiss

  100. Abril Montealegre

    26-Ago-2010 en 10:27 pm

    no puedo creerlooooooooooooooooooooo
    quiero ir!!!!!! porfa porfa porfa porfa porfaaaa

  101. Gabriel Alejandro Chavez B.

    26-Ago-2010 en 10:35 pm

    Buenisimo que peter Frampton venga a chile, afirmando aún mas los últimos meses que serán los de conciertos Legendarios!!..

    una trayectoria inmensa y ojalas que me regalen las entradas :D!!!..ya que me encanta peter frampton

  102. María Luisa Vega

    26-Ago-2010 en 11:13 pm

    es un gran músico y cantante la guitarra habla, es buenisimo y no me lo puedo perder, seria un sueño hecho realidad ver a Peter Frampton, gracias por dar la oportunidad de participar, ojala gane.

  103. Hernán Pérez

    26-Ago-2010 en 11:15 pm

    Grande Frampton, el último gran artista que ha visitado la quinta vergara, y el menos aplaudido. Falta cultura y desarrollar el oido.
    Saludos y rajense con la entrada

  104. Michelle Vallejos

    27-Ago-2010 en 12:15 am

    yo please!!!!!!!!!!!!

  105. Sebastian Ortiz Vivanco

    27-Ago-2010 en 12:27 am

    uhhhhh seria muy genial verlo en vivo, garcias a el me construi un talk box! secooo!!!

  106. Ximena Ovalle

    27-Ago-2010 en 12:46 am

    Bueno que puedo decir de Peter es una gran leyenda ,un gran musico vocalista ,guitarrista,compositor ,.Tuve el priviligio de verlo cuando actuo con Journey hace algunos años y quede marivilladsa con el show de primer nivel .El necesitsa una megagrupo para tocar en el escenario con su guitarra le basta y sobre hasta la puede hacer hablar verdaderamente un genio y me da mucha penas que no le dieron la importancia que ameritaba en su actuaciond en Viña del mar a la cual no pude asistir y tuve que conformarme con verla en la tele y para mi ha sido uno de los mejores shows de Viña pero ahora no quiero perder esta oportunidad de ver a este gran genio asi que espero poder ganar el concurso
    La xime

  107. Daniela Alarcon Gonzalez

    27-Ago-2010 en 2:33 am

    PLEASEEEEEE! UNA PARA MI! este fin de año no hay bolsillo rockero que aguante, y me encantaria poder ver a Peter Frampton, solo pude alucinar por la tele cuando toco en Viña.
    Porfis acuerdense de miiiii 😀


  108. Francisco Hoffmann

    27-Ago-2010 en 4:46 am

    Peter Framptom!!! …. buenisimo … uno de los grandes, hay que ir a verlo si o si. Auspisiense con una entradita please!!!

    Saludos humonegro

  109. richard flores barrueto

    27-Ago-2010 en 8:57 am

    Ojala pueda ver al maestro…………Grande Humonegro!!!!!!!!!!

  110. Roberto J. Zamorano

    27-Ago-2010 en 12:43 pm

    que buena, ojala pueda ganar una entrada

  111. Esteban Paredes

    27-Ago-2010 en 2:03 pm

    Ojalá pueda obtener una entrada para mi viejo, sería un buen regalo para él y para nosotros que hemos sido herederos de su música.

  112. fabian orellana

    27-Ago-2010 en 6:50 pm

    vamos que se puede por esa entrada !!!!

  113. Alvaro Cabrera Montino

    27-Ago-2010 en 6:57 pm

    vamo vamo!!!! a ver al tatita rockero!!!

  114. Camila Rojas

    27-Ago-2010 en 7:14 pm

    hay! yo tambien quiero una entrada, aun que creo que llegue tarde 😛 sería tan pero tan tan genial escuchar a este grande en vivo, tan genial *O*

  115. Juan Mucarquer

    27-Ago-2010 en 7:44 pm

    me sumo al sorteo!

  116. Felipe Arias

    27-Ago-2010 en 8:20 pm

    Unas entradas por favor!

  117. Sergio Schnohr

    27-Ago-2010 en 8:24 pm

    Acá participando de una entradita pa’ ir a ver al maestro Frampton….

  118. SebastiánZz

    27-Ago-2010 en 8:52 pm

    si o si voy, pero si es con invitacion aun mejor asi puedo yo invitar a mi viejo y no que me siga invitando el a mi ajaj, eso, de que estamos, estamos…

  119. Rodrigo Eduardo Rojas Casanova

    27-Ago-2010 en 10:55 pm

    wooo, grande y su cover de Black Hole Sun!

  120. Felipe Alberto Oñate Carvajal

    27-Ago-2010 en 11:49 pm

    uhh ;D me encantaria ganarme una entrada para verlo, peter frampton es alguien que debe ser visto en vivo, y su concierto coincide con mi cumpleaños, no podria haber mejor regalo ;D

  121. Diego Berrios

    28-Ago-2010 en 12:10 am

    a mi viejo y ami nos encanta Peter sería filete ir con el, ojala ganarse la entraditaa!

  122. Alvaro Francisco Pulgar Jara

    28-Ago-2010 en 2:40 am

    si me gano las entradas se las regalo a mi viejo!
    jajja ojala =)

  123. Eduardo Callejas

    28-Ago-2010 en 3:54 pm

    Me encantaria tener una entrada para verlo… fanatico al 100%, me encanta su musica 🙂

  124. Mario Alvarez Tapia

    28-Ago-2010 en 5:23 pm

    grande peter, un sueño poder ir a verlo, ojala se cumpla :D, saludos

  125. Nicolás Aravena

    28-Ago-2010 en 6:36 pm

    Es un maestro. Obvio que me encantaría estar ahí

  126. Rafael Troncoso

    28-Ago-2010 en 10:32 pm


  127. patricia

    29-Ago-2010 en 12:00 am

    buenisimo peters eres gran exponente de todos los tiempos

  128. Mauricio Ivan Huaracán Marinao

    29-Ago-2010 en 12:38 am

    Yo quiero!! D:
    Fraptom es una leyenda del rock!
    espero poder ganarme las entradas, porque con rush quede pato 🙁

  129. Karin Cartagena

    29-Ago-2010 en 1:39 am

    Please Amigos de Humonegro,Peter es genial, ademas,el 4 estoy de cumple!,si me gano la entrada sera el mejor cumple de todos los tiempos y ustedes seran los responsables de tal alegria.Peter rules!!!!

  130. sebastian rodriguez

    29-Ago-2010 en 12:50 pm

    rajense con una entrada! =D

  131. maria eugenia manriquez

    29-Ago-2010 en 12:51 pm

    por fis…mi amor de lola!!!!!!

  132. Natalia Silva

    29-Ago-2010 en 12:59 pm

    Como dicen en Family Guy, quiero verlo para escuchar ese mìtico sonido….guaaa guaguaguagua jajaja

  133. Roberto M.

    29-Ago-2010 en 2:06 pm

    Quiero ver a Peter!
    Show me the Way!!!

  134. Ignacio Muñoz Alarcon

    29-Ago-2010 en 2:17 pm

    😀 una entradita aqui plis (=

  135. sandra katherine piña sanchez

    29-Ago-2010 en 2:59 pm

    hola siempre paso por aquí para enterarme de cositas, pero esta vez no dudo en escribir me encanta Peter aunque no soy de esa época para nada siempre me a gustado mucho no pude verlo en el festival estaba trabajando esa vez y como siempre los jefes no tiene consideración por el amor a la buena música jijiji 😀

    Ojala pueda ganar una entradita para ir porque la verdad son igual caras las entradas…

  136. Daniela Echiburu

    29-Ago-2010 en 3:43 pm

    Yo quiero la entradaaaaaaaaaa!!!

  137. Eugenio Cabrera

    29-Ago-2010 en 8:15 pm

    Seria un sueño poder ver a Peter en Chile,claro por que lo sigo de los 16 años, con el Frampton Come Alive, lo escuche por primera vez en rock concert en la Chilena y luego en The Midnihgt Special con Pirincho Carcamo, el 77 Me compre el l,m inyou (vinilo), con algunos pesos que junte con lo que me daba mi papi, espero poder estar en este super evento
    junto a un gran músico, Gracias.

  138. carmen vega

    29-Ago-2010 en 9:12 pm

    hola por favor necesito que regalen entradas para mi tio que es Geno de Quilicula el es fanatico mas fanatico que existe , es su idolo desde la niñez y se muere si no lo ve, de hecho aprendio a tocar guitarra por el.. ademas que me diria toda la vida que no lo ayude a ganarse las entradas.

  139. Vicente López Magnet

    29-Ago-2010 en 9:39 pm

    wena chorizos
    rájense con entradas pa ver al maestro frampton 😀

  140. Pablo Sotomayor

    30-Ago-2010 en 12:02 am

    fantastico como ha evolucionado este gallo, soy fanatico desde los 15 y de eso hace muuuuuuchos años, incluso mis hijos lo son. seria bakan ir papa y niños, a verlo y gritar juntos

  141. Gabriel Arriagada

    30-Ago-2010 en 1:12 am

    Peter Framton, grande entre los grandes. Toca la guitarra de una manera increíble. Creatividad y estilo. Cuñado lo vi el 2008 experimente una emoción como en pocos conciertos al escuchar “do you feel like we do” mi tema favorito. En el caupolican será otra cosa. Sin duda un show para no olvidar. Saludos a todos los fanáticos.

  142. Pablo Galdames

    30-Ago-2010 en 2:01 am

    OOOOHH Quiero ganar una entrada!!!! tremendo guitarrista, espero poder ir, seria tremendo honor!!!
    gracias y saludos!

  143. Pablo Leal Amaya

    30-Ago-2010 en 7:15 am

    Uno de los grandes! me encantaria poder verlo.

  144. Ana Maria Soto

    30-Ago-2010 en 9:20 am

    Quiero regalar la entrada a mi hermano, ya que le encanta, y esta pasando por un mal perido de salud, ojala pueda ganar para regalarsela gracias.


    30-Ago-2010 en 10:17 am


  146. Camilo Gonzalez Bracamonte

    30-Ago-2010 en 11:43 am

    Es lejos uno de los mejores guitarristas y rockeros de los 70-80. Deberia nuevamente dejarse el pelo largo como todos los rockeros. 🙂

  147. Leyla

    30-Ago-2010 en 11:45 am

    Hola!!! La verdad me enteré sólo hace un par de días que Frampton venía, y aunque me encanta su música, si gano la entrada se la regalo a mi querida madre. Ella y Frampton comparten una historia de hace muuuuuchos años! hahaha Se las cuento…?

    Cuando mi mamá tenía 21 años, en 1980, se fue a Brasil a visitar a su hermana. Para el carnaval de Río, un día ella estaba en un restaurante con vista al carnaval, en un lugar muy exclusivo y VIP… tanto así que en el rato que ella estuvo cenaron ahí personajes como Elthon John y Peter Frampton. Y casi nadie los pescaba porque eran “artistas”, y la gente que había ahí era demasiado “high society”, entonces les daban lo mismo.

    En esa época mi vieja amaaaaba a Peter Frampton, le encantaba, le movía el piso hahah y bueno, obviamente lo vio y quiso conocerlo, así es que llamó al mesero y le dio una nota que decía que quería conocerlo y saludarlo de un beso, si no le molestaba interrumpirlo. Él lo leyó, le sonrió y le hizo una seña con la mano para que ella se fuera a sentar a su mesa. Y la muy patuda de mi madre le dijo que no, que él se viniera a sentar a la suya! hahaha. Y bueno, eso hizo! Compartieron un buen rato juntos, y él le dijo “tu me querías dar un beso” se le acerca y se dan el beso, pero en la boca! hahaha y digamos q no fue precisamente un piquito. Yo creo que mi vieja veía estrellas en ese momento. En fin, compartieron un rato y luego se despidieron. Y bueno lo típico, el guardaespaldas de él le preguntó a mi mamá si quería seguir el resto de la noche con él porque iban a otro lugar y quería estar con ella, pero mi mamá ya se imaginaba que seguía después haha así es que a sus 21 años mejor le dijo que no, con el dolor de su corazón. Y bueno, esa fue la última vez que lo vio.

    Que más les puedo decir… no cuento con la plata para comprarle una entrada, pero sería espectacular que me la regalaran y darle la sorpresa a mi vieja!! Que hasta el día de hoy ve los videos de Frampton y se acuerda de su historia en ese restaurante de Brasil hahaha y de su mirada “coqueta y sexy” con los ojos “medios cerrados” como dice que siempre los tenía hhahhhah.

    (Bueno, ella ME MATA si sabe que la publiqué en un muro abierto hahahaha pero es un riesgo que me atrevo a correr, sin decirle! ojalá valga la pena y le pueda dar la sorpresa!) 😀


  148. Javier C

    30-Ago-2010 en 1:02 pm

    En verdad me encanta la musica de peter… el problema es q no tengo plata y jamás he ganado una dichosa entrada en mi vida XD

    Ruego a la gente que esta organizando esto que por favor me haga favorecido.. estaría eternamente agradecido. SAludos

  149. Esteban del Rio

    30-Ago-2010 en 2:53 pm

    Buena amigos! excelente actitud esta de regalar entradas para los que por el money no podremos comprarla.
    Abrazos y exito!

  150. Verónica Barriga

    30-Ago-2010 en 3:41 pm

    Nunca se sabe si la suerte está de este lado, aguante el rock and roll, que gane el que tenga que ganar…”Alia jacta est”

  151. Patricio Mancilla

    30-Ago-2010 en 3:48 pm


  152. Paloma Alejandra Poisson Bustamante

    30-Ago-2010 en 4:48 pm

    yo quiero una entrada !!!!!

  153. Franco López Usquiano

    30-Ago-2010 en 4:57 pm

    Se agradece la iniciativa!

  154. Valeska Gabriela Soto Sierra

    30-Ago-2010 en 5:42 pm

    aha , mi mamá es fanatica de él y me dá tanta risa cuando cuenta sobre los pósters que tenia en su pieza en los cuales peter tenía pelo y chochos , una frondosa cabellera … aha como pasa el tiempo … y es increible , porque yo me pongo a pensar qué pasará con Dominic , Matt o Crhis De muse … cuando estén hecho mierda xD en unos cuantos años más y al igual que mi mamá … yo seguiré diciendo ” ay si es taan lindo ” como una buena groupie 😀 y bueno , sería más que genial poder regalarle una entrada a la eterna groupie de mi madre :), saludos

  155. Claudio adrian marambio arellano

    30-Ago-2010 en 8:20 pm

    wow!!!!, bakan!, unas entradas vendrian de lujo para disfrutar a tan grande artista!

  156. Ivett Gutiérrez Guerrero

    30-Ago-2010 en 9:16 pm

    Yo sería demasiado feliz con asistir a este concierto, mi ídolo desde mi juventud, yo lo bailaba cuando estaba de moda, o sea, cuando era hit…

  157. Nelson Castro

    30-Ago-2010 en 10:20 pm

    ok… vamos quiero mis entradas, gracias eh

  158. Nelson Castro

    30-Ago-2010 en 10:26 pm

    yo encontre unos vinilos de Peter Frampton,aca en un persa comes alive.
    estan un poco viejos ,pero con caratula original de los vinilos…
    pero aun no los puedo escuchar.

  159. Jorge Cancino Jara

    30-Ago-2010 en 10:57 pm

    Espero poder ganar de verdad que me estoy desesperando por no tener plata y querer ir a un recital inolvidable, saludos muchachos y gracias por la oportunidad de participar!

  160. Sonia Fuentes

    30-Ago-2010 en 11:21 pm

    Ojalá poder ir a ver a este verdadero genio del rock, a este ídolo de la guitarra, a este portento que escribió temas que hasta hoy son clásicos, al creador de uno delos discos en vivo más cotizados de la historia, al gran integrante de la increible banda Humble Pie. ¡Quiero un ticket amigos, lo conozco de siemrpre y me encanta. Sería una feliz ganadora!

  161. Alejandro G.

    30-Ago-2010 en 11:26 pm

    Grandísimo Frampton, un genio del rock, un virtuoso. Añoro ir a verlo. ¡Saludos amigos!

  162. Fermín Gómez.

    30-Ago-2010 en 11:33 pm

    Quiero ir a ver al genial Frampton, tremendo músico en la historia del rock.

  163. Aldo Fabian Abarca Ortega

    31-Ago-2010 en 2:12 am

    Seria expectacular ganarme las entradas para ver a este icono !!

  164. Sebastian no tiene nada que hacer aca.

    31-Ago-2010 en 2:49 am

    no tengo nada que hacer para aca.. solo son para regalarselas a mi vieja…
    cuando saquen pa pennywise ahi concursare por voluntad propia XD

  165. Claudia Huerta

    31-Ago-2010 en 3:32 am

    ojala me gane las entradas!
    genio Frampton !

  166. Antonio Araya

    31-Ago-2010 en 8:56 am

    A mi polola le encantaría ir, ojalá me las gane

  167. Mabeel Plötz

    31-Ago-2010 en 10:08 am

    jajaja mi papa morirá de envidia si me gano la entrada!
    xfaa x akaaaa :D!

  168. Luis Caceres

    31-Ago-2010 en 10:11 am

    Sería genial si me pueden da un par de entradas, un verdadero sueño para ahora si poder ver a este maestro. SALUDos!!

  169. Diego Valenzuela

    31-Ago-2010 en 10:42 am

    Por favor rajense con unas entraditas ya uq eno hay plata para ir a ver a este capo, un saludo desde valparaíso

  170. Daniel Bloomfield

    31-Ago-2010 en 10:57 am

    Me encantaria ir al show de este gran guitarrista.
    Espero ser uno de los afortunados ganadores

  171. Marisol Leyton

    31-Ago-2010 en 11:08 am

    Porfaa quiero ganarme unas entradas!!! Me encanta Peter Frampton
    Gracias por el concurso!

  172. cesar martinez seguel

    31-Ago-2010 en 1:21 pm

    hola amigos de humo negro me muero por ir a ver a framton tengo todosw sus discos incluyendo su paso por humble pie sere un agradecido de ganar una entrada saludos y gracias muy buena iniciativa


    31-Ago-2010 en 2:25 pm


  174. Catalina Acuña Moya

    31-Ago-2010 en 2:58 pm

    Me encantaría ganarmelas! gracias.

  175. Marialicia Obando Madrid

    31-Ago-2010 en 3:26 pm

    Sería feliz yendo al recital. Gracias !!
    Hugs and Kisses.

  176. Eduardo Aranda A.

    31-Ago-2010 en 4:02 pm

    Es heavy tener la oportunidad de poder disfrutar de un concierto con este artista que siempre esta vigente por su calidad y rockero de verdad no envasado,,,me gustaria poder ganar las entradas ya a mis cincuenta añitos tener la oportuidad de llevar a mi hija de 15 alos que le gusta el rock y eso me satisface como papa y amigo de ella ya que es lo único que tiene debido a que su madre ha partido y la musica nos une especialmente el rock, “” Viva Peter Frampton y viva el Rock”” y viva la musica en general, es arte, es vida, es sociabilidad y es placer,,,,,
    Por lo mismo este artista me ha marcado en mi adolescencia de muy gratos recuerdos. OJALA ME PUEDA GANAR EN EL SORTEO AUNQUE SEA ARRIBA DEL TECHO NO IMPORTA……………….

  177. Andres Saldias

    31-Ago-2010 en 4:43 pm

    Siempre me rajo escribiendo y nunca gano.. asi que ahora no tengo mucha fe pero ojala gane… Saludos keep on rockin

  178. Diego Fernando Díaz Guzmán

    31-Ago-2010 en 9:57 pm

    quiero una entradaaa … porfa !!
    es para mi viejo a quien le encanta Peter
    ojala se pueda.. 🙂

  179. Claudio cabrera

    31-Ago-2010 en 9:58 pm

    seria increible poder asistir a este magno evento ya que soy muy fanatico desde muy niño y ahora que se da la oportunidad de ir no tengo ni uno ya que quede sin pega hace poco y tengo muchas deudas y esto me aliviaria un poco mi estress gracias

  180. Arlette benavente

    31-Ago-2010 en 10:34 pm

    woo ojala gane!!

  181. René

    31-Ago-2010 en 11:16 pm

    Thank you Mr Churchill que buen album!!!..ojala pueda decir además thank you for the tickets!!!

  182. Daniel Retamal

    01-Sep-2010 en 12:00 am

    No tengo dinero. De verdad solo dependo de ustedes.

  183. Rocio Ortiz Soto

    01-Sep-2010 en 12:15 am

    quiero ver al idolo!!!

  184. natalia subiabre

    01-Sep-2010 en 12:17 am

    Yo quiero ir se los suplicoooooo

  185. Cristhian Reyes Barrera

    01-Sep-2010 en 1:28 am

    Huu ojala me ganase una!

  186. Marcelo Aguilera Lastra

    01-Sep-2010 en 2:26 am


  187. oscar ogalde zavala

    01-Sep-2010 en 8:45 am

    este tipo es un grande! acuerdense de mi!

  188. Francisco

    01-Sep-2010 en 11:30 am

    Vendo 2 entradas tribuna general en $20000. cel 093199408

  189. olga cristina

    01-Sep-2010 en 2:42 pm

    hola siuper la pag siempre paso a enterarme de cosas pero nunca concurso.. pero esta vez lo amerita ojala me gane las entradas


    01-Sep-2010 en 5:50 pm

    Soy seguidora de Frampton desdemlos 16 anos, me parece lejos lo mejor en junto a Erick Clapton y he tenido todos sus discos en acetato y cd, dvd, tambien estuve en el Festival de Vina del Mar el dia que vino y al dia siguiente tenia mi ticket para Sn carlos de Apoquindo y volvi al show junto a Journey and E W and Fire, tuve que esperar serca de 30 anos para poder disfrutar de este Maravilloso guitarrista musico y excelente persona, porsupuesto que quiero una entrada, aun no compro para el 4 de set…Gracias

  191. Pepe Morales

    01-Sep-2010 en 6:16 pm

    Soy fanático de Peter Frampton y de la película “Reality bites”. Me encantaría verlo en vivo y sobre todo gracias al auspicio de Humo negro. ¡Qué mejor!

  192. oscar francisco peralta martinez

    01-Sep-2010 en 7:25 pm

    ojala gane la entradas para ver a este talentoso y virtuoso guitarrista 😀

  193. Carlos Ego Aguirre

    01-Sep-2010 en 7:57 pm

    Para los que descubríamos a Peter Frampton aún adolescentes en 1976, y no parábamos de escuchar el Long Play Comes Alive una y otra vez, (y no pudimos verlo en Viña), es casi un deseo místico estar esta vez en el teatro. Más de 30 años de espera no es poco. Ahora, con hijos y deudas a cuestas, muchos de aquellos recordamos los “lentos” en las fiestas con luces psiciodélicas y propiniendo pololeo a la chica que nos gustaba susurrándole al oído “I can see the sunset, in your eyes”. Y claro, un ticket no nos vendría mal, y si es con 5 minutos de cgharla en backstage, mucho mejor. Saludos,
    Jóvenes, este tipo Frampton es de ésos a los que hay que oir con los ojos cerrados y los 5 sentidos.

  194. Daniel Miranda

    01-Sep-2010 en 7:59 pm

    Frampton es un genio con la guitarra, un maestro del buen rock. La vez anterior no lo pude ver, solo vi su show en viña.
    Esta vez no hay dinero y muchos conciertos buenos.
    Espero tener posibilidad de ganar la entrada, ya que se que somos muchos que estamos en las mismas.

    Aguante el rock
    Aguante Frampton

  195. Rodolfo

    01-Sep-2010 en 8:21 pm

    Genio Frampton le quedo gustando chile, lamentablemente no alcanza para la entrada … Vamos HUMONEGROO TE QUIERO VEER !!!
    ojala me gane una entradita GRACIAS

  196. Rodolfo Jofre Saavedra

    01-Sep-2010 en 8:23 pm

    Genio Frampton le quedo gustando chile, lamentablemente no alcanza para la entrada … Vamos HUMONEGROO TE QUIERO VEER !!!
    ojala me gane una entradita GRACIAS
    se me olvidaron los apelleidos 😛

  197. Eliana Francisca Carreño vegas

    01-Sep-2010 en 9:44 pm

    A cruzar los dedos para ganar la entrada

  198. Guillermo

    01-Sep-2010 en 10:31 pm

    Seria muy hermoso poder ir a ver a Peter, en especial junto a mi madre y recordar mi niñez a su lado ya que gracias a la vida me crio desde pequeño con buena musica adios abrazos y que esten bien

  199. Ignacio Alonso Araya Albornoz

    02-Sep-2010 en 12:16 am

    Grande humonegro ! siempre se la juegan

  200. Daniel venegas

    02-Sep-2010 en 1:18 am

    bueno vengo esperando el recital desde su ultima venida al festival el cual vi por la tele no habia plata para ir a viña.. ahora recien nacio mi hijo y sin dinero me encuentro, asi que quisiera ver si viene la marraqueta bajo el brazo jojo, bueno y si no me la gano hire a escuchar de afuera.. grande peter viva chile vivan los mineros!! viva mi martin…

  201. Felipe simón piña vásquez

    02-Sep-2010 en 4:36 am



    02-Sep-2010 en 10:13 am

    Quien no bailó en su juventud un tema de Peter en alguna discoteca, y humm!!! que recuerdos y me gustaría repetirlo, pero ahora con él en vivo y estoy segura que los vuelvo a bailar, ojalá que tenga alguna opción, agradecida de quién lo trae, y pienso que se demoró mucho en venir, viva Peter Frampton ……………..Lily.

  203. Judith

    02-Sep-2010 en 11:24 am

    En pocas palabras, me encanta, me encanta su música mis mejores años de la adolescencia estuvieron acompañado con su música, hasta el día de hoy al escucharlo vivo con los recuerdo, es un cantante de gran trayectoria, es un complemento de buen cantante con una simpatía única, demás esta decir que me encantaría poder ir a disfrutar en vivo de su inigualable voz…

  204. Hugo Morales Gallardo

    02-Sep-2010 en 11:47 am

    Wow, ojala pueda estar alla, felicitaciones por los grandes concursos!

  205. Juan

    02-Sep-2010 en 11:54 am

    Excelente concurso, espero ganar una entrada.

  206. Francisco Latapiat Arévalo

    02-Sep-2010 en 11:57 am

    Estimados, la música de este hombre es cuatica para mi (uuuuu).
    espero ganar un abrazo

  207. Jorge Aranguiz

    02-Sep-2010 en 12:40 pm

    BKN!!!! seco este compadre…favor considerarme en el concurso…en viña estubo genial…mejor seria verlo en vivo.

  208. Carolina

    02-Sep-2010 en 1:23 pm

    Me encantaria ganarme estas entradas!!!

  209. sergio quiroz

    02-Sep-2010 en 2:31 pm

    Mañana estoy de cumpleaños quiero ir tengo 42 años

  210. Jorge Avila

    02-Sep-2010 en 3:40 pm

    Hola, Quiero ganarme una entrada ya que hay muchos conciertos y poca plata pa ir a todos..

    Saludos HumoNegro !!

  211. patricio mondaca

    02-Sep-2010 en 3:52 pm

    Seria bueno poder participar e ir a disfrutar uno grande del Rock.
    Grande Peter, de lolo que lo escucho.
    Suerte, ojala salir sorteado

  212. Camila Merino

    02-Sep-2010 en 3:53 pm

    Quiero una entrada porfa!

  213. Cristian Salinas

    02-Sep-2010 en 3:53 pm

    Hace tiempo quiero verlo. Cuando vino la otra vez estaba fuera de Chile!

  214. daniel garin

    02-Sep-2010 en 7:16 pm

    grande peter , ojala gane 🙂

  215. felipe ramirez muñoz

    02-Sep-2010 en 10:43 pm

    uuuu baby a love your way !!!! everyday eeeeeveryday !!!! aguante peter !!! yo se que con la ayudita de humo negro te voy a ir a acompañar esta vez, ya que en viña solo lo bacile en la tv, con los amigos y las pilseners.

  216. Daniela lewysohn

    04-Sep-2010 en 3:12 pm

    hola amigos.
    por motivos de fuerza mayor no podre asistir a este gran evento.
    Tengo dos entradas palco. y las dejo las dos en $30.000
    por si tienes dudas aqui dejo el link. y numeros de contacto

    • mario alvarado

      08-Sep-2010 en 4:31 pm

      hola Daniela
      Siento molestarte con un asunto que no tiene nada que ver. Estoy tratando de ubicar a Claudio Lewysohn Papalli, de quien fui vecino en Miraflores, Viña, donde continuo viviendo. Yo supongo que eres hija de el, y si es asi, te rogaria le hicieras llegar mi mail. Me gustaria mucho volver a saber de el despues de muchos, muchos años. Gracias.

      Mario Alvarado

  217. pedro gajardo

    07-Sep-2010 en 10:33 pm

    leyenda de las seis cuerdas y majestuoso musico que pertenecio a humble pie.

  218. rafael tortolero jimenez

    21-Jun-2011 en 9:43 pm

    el mejor guitarrista de todos los tiempo estare con ustedes en ese concierto en espiritu disfruten y les vendran bonitos recuerdos cuando escuchen su musica, paz.



Congreso anuncia su primer concierto vía streaming



Novedades sobre Congreso, ya que la agrupación confirmó la realización de un show vía streaming para el próximo 27 de diciembre a partir de las 17:00 hrs. La cita, que será transmitida desde Matucana 100, se centrará en una revisión a los principales hitos de su carrera, incluyendo un conversatorio en vivo con el público. Adicionalmente, la banda interpretará por primera vez su single “La Plaza de los Sueños“, a estrenarse el 18 de diciembre en plataformas de streaming.

Nos entusiasma mucho vivir una nueva primera vez como banda. En este caso, lo que más nos gusta de este primer concierto por streaming de Congreso es que podrá ser visto desde cualquier parte del mundo, así que esperamos que llegue mucho público de fuera de Chile y que puedan ser parte del conversatorio que realizaremos después del show”, comentó a través de un comunicado el saxofonista de la agrupación, Jaime Atenas.

La venta de entradas está disponible a través del sistema Ticketplus. Estos son los valores:

  • Preventa 1: $5.298
  • Preventa 2: $6.357
  • General: $8.476

Seguir Leyendo

Podcast Cine E36


Podcast Música E36



Letter To You Letter To You
DiscosHace 3 días

Bruce Springsteen – “Letter To You”

A través de su carrera, Bruce Springsteen ha musicalizado la juventud de múltiples generaciones. Los clásicos solos de saxo, su...

Canciones Para El Siglo XXI Canciones Para El Siglo XXI
DiscosHace 4 días

Poder Fantasma – “Canciones Para El Siglo XXI”

Tierra fértil para el pop ha sido nuestro país. Con una rica tradición y un variado catálogo a punta de...

Atlas Vending Atlas Vending
DiscosHace 5 días

METZ – “Atlas Vending”

Luego de haber publicado el compilatorio “Automat” en 2019, el trío canadiense METZ tenía a todos muy atentos por un...

Endless Twilight Of Codependent Love Endless Twilight Of Codependent Love
DiscosHace 1 semana

Sólstafir – “Endless Twilight Of Codependent Love”

Últimamente, la casa discográfica francesa Season Of Mist ha estado pendiente de lo que ocurre en Islandia en términos musicales....

Post Human: Survival Horror Post Human: Survival Horror
DiscosHace 2 semanas

Bring Me The Horizon – “Post Human: Survival Horror”

La emergencia sanitaria por el Covid-19 ha sido uno de los sucesos que más ha afectado al ambiente artístico. Lo...

Song Machine, Season One: Strange Timez Song Machine, Season One: Strange Timez
DiscosHace 2 semanas

Gorillaz – “Song Machine, Season One: Strange Timez”

Lo de Gorillaz siempre ha tenido que ver con dar vida a un espacio donde las cosas pueden ser llevadas...

Vökudraumsins Fangi Vökudraumsins Fangi
DiscosHace 2 semanas

Auðn – “Vökudraumsins Fangi”

Islandia es tierra mágica en cuanto a creación artística. Con una población que bordea los 400 mil habitantes y paisajes...

Lament Lament
DiscosHace 3 semanas

Touché Amoré – “Lament”

Después de su emocionalmente devastador cuarto larga duración, “Stage Four” (2016), Touché Amoré vuelve a remover fibras profundas con “Lament”,...

DiscosHace 3 semanas

Cómo Asesinar A Felipes – “MMXX”

A estas alturas, es un hecho que Cómo Asesinar A Felipes va más allá de la idea tradicional de banda....

Fake It Flowers Fake It Flowers
DiscosHace 3 semanas

Beabadoobee –”Fake It Flowers”

Cada vez es más aparente el estado cíclico de la música. Las generaciones nuevas ven como novedoso cosas que las...


Más vistas

A %d blogueros les gusta esto: