Peter Frampton en Chile: Ganadores

Miércoles, 25 de Agosto de 2010 | 3:06 pm | Comentarios (224)

Peter Frampton sigue siendo uno de los artistas y guitarristas más reconocidos de la historia del rock. Nacido en Londres, estudió en la Escuela Técnica de Bromley y fue compañero David Bowie (con quien más tarde grabó y giró). A los 16 años, fue cantante y guitarrista de la banda de adolescentes británicos, The Herd y más tarde de la reconocida Humble Pie. Su quinto álbum en solitario, “Frampton Comes Alive!”, es considerado uno de los mejores y más vendidos discos en vivo de todos los tiempos.

Sus seguidores tendrán la posibilidad de verlo en Chile de forma individual este próximo 4 de septiembre en el Teatro Caupolicán. El 2008 estuvo en el Festival de Viña, pero ahora vendrá a deleitar a sus seguidores con su último álbum titulado “Thank You Mr. Churchill” y sus mejores éxitos como “Baby, I love your way”, “Do You Feel Like We Do”, “Show Me The Way” o “I’m In You”, entre otras.

El inglés de 60 años dice estar mejor que nunca, “Tuve que hacer lo que era necesario para llegar a donde estoy ahora, pero a lo que me refiero es la claridad que tengo, disfrutar la creatividad es mucho mejor”, insistió el músico a un diario argentino.

Su nueva producción, “Thank You Mr. Churchill” su decimocuarto trabajo de estudio, fue lanzado en abril de este año y que incluye su primera colaboración con su hijo Julian. Contiene 11 temas coproducido por Frampton y lo muestran muy reflexivo con los temas de su entorno. “Este álbum es muy autobiográfico”, dijo Frampton. “Comienza con el nacimiento donde yo le agradezco a Mr. Churchill, haber traído a mi padre de vuelta de la Segunda Guerra Mundial”. Grabado en el estudio de su casa en Cincinnati, esta última placa tiene temas profundamente íntimos, tejiendo cuentos de la pérdida, el amor y la redención y la experiencia adquirida a lo largo del camino.

En HN tenemos invitaciones para sortear entre quienes dejen un comentario (abajo). Coloca tu nombre completo en el campo indicado, y un email válido de contacto.

GANADORES:

Natalia Subiabre
Ignacio Alonso Araya Albornoz
Daniel Retamal
Rocio Ortiz Soto

Entradas ya a la venta a través de sistema Ticketmaster.

Valores: $18.000, $25.000, $40.000 y $60.000.

Enlace corto:
(224)
  1. Daniel Zaror says:

    vamos que se puede, esta vez si quiero ganarme una entrada T_T

  2. ohh maestro peter frampton en viña estuvo la raja y despues andaban pelando que fue demasiado largo, eso para quienes no estan acostumbrados a shows de calidad.
    que ganas de ir pero ya me gaste la poca plata que tenia en Rush!

  3. Mauricio says:

    No lo pude ver la vez anterior. Quiero ir!!! Gracias Humo Negro por favor concedido.

  4. Juan Estay Ruggieri says:

    Yo quiero una entrada, puede ser una oportunidad que no se repita otra vez 😀

  5. daniela perez says:

    yo quieroo una invitacion!! 🙂 estaría muy agradecida

  6. Juan Pablo Salas Fernández says:

    Yo quiero ir a ver a Peter Frampton !!!!! , bueno también quiero ir a ver a El Cruce de lujo y a Pennywise …. mmm. Bueno la idea es esa …. jajajajaj
    Saludos !.

  7. Janina Aguilera Lara says:

    Ojalá pueda ganar entradas… En estos tiempos donde todos los días despiertas y te preguntas si los grandes músicos de la historia aún viven, estas oportunidades son incomparables.

  8. Juan Alarcón R. says:

    ufffff!!! tremendos conciertos que se acercan, lastima que no alcanza la $$$ para ir a todos… PORFA UNA ENTRADA PARA EL POBRE JUAN!!!!

  9. hernan acosta says:

    saludos ,bna pagina y obvio que quiero una entradita pa ver al maestro .

  10. Anna Harkko says:

    Show me the way para ganar esa entradita.

  11. Marcos Alvial says:

    Ahora si, tengo que ganar una invitación…

  12. grande frampton. un maestro de la guitarra. ojalá pueda ganar una entrada para ver a este grande

  13. felipe rodriguez santa maria says:

    yo quiero una entrada para ver a frampton!, la ultima vez que vino no pude verlo y mori!!, creo que no se puede morir 2 veces asi que porfaaa una para mi!!!

  14. Gabriel Ignacio Braukmann says:

    pye ya mande para anthrax locoo xD pero si me llega cualquiera de estas bkn wm la wea es pasarla bkn disfrutar de un buen rock con Frampton quien no lo pasa bien asi que a disfrutar del rock y la entrada tiene que ser mia po Humor Negro xD

  15. pedro villalobos says:

    una entradits por favor. quiero ir y cantar wawawawawa wawawawawa waa

  16. Maria Fernanda Baeza says:

    EE !!! yo quiero una !!!

  17. Baltazar Sanchez Escobar says:

    yo kiero sx entrada pa ver al maestro…

  18. Claudio andres Leiva Lopez says:

    lejos el mejor año musical de chile, TODOS LOS GRANDES ARTISTAS VIENEN VENDRAN O VINIERON!!!!!!! +100000000000 pal bisentenario de chile y su gran cantidad de artistas

  19. mario troncoso M says:

    ahora si q si espero ganarme la entrada!!! saludo

  20. Carlos Guerrero Munita says:

    Quiero ver al seco de Peter!!!

  21. Angelina Zuñiga says:

    yo quiero una entrada!

  22. Show me the way !!!!! YO QUIERO

  23. Mauricio Gajardo says:

    Yo también quiero una! xD salu2

  24. Maria Guerrero Gajardo says:

    es mi amor platónico…lo unico que quiero es verlo nuevamente!!! una entrada por aqui pliiis

  25. Juan Carrasco says:

    Creo que fue mi primer disco en vivo el Framptom Comes Alive y no pude ir cuando vino a Viña, asi que si es que no voy ahora lo mas probable es que este muy viejo y no venga, jajaj saludos.

  26. nicolas faundes says:

    o.o q bkn me gutaria demasiado ir pero el bolsillo no aguanta tantos evnetos pueden ayudarme con entrada plis ??? 🙂

  27. Fabrizzio Dagnino says:

    Tremendo Frampton y sus cover grunge !!!

  28. Pablo Moya Astorga says:

    Me encantaría escuchar hablar la guitarra de Frampton, debe ser genial. Ayer veía “Casi Famosos” y caché que Frampton hace un cameo, como manager de Humble Pie, jajaja. Después me fui a google a investigar y claro, era él; y además de eso, asesoró al actor que hace de Russel Hammond con la guitarra, y en la película el personaje dice “Quién podría pedir un mejor profesor que Peter Frampton?”. NOTABLE

    Bueh, por esto mismo me gustaría ir, para poder sentir aunque sea hora y media la mística de los ’70. Sería excelente.

  29. Sebastian Mella S. says:

    Wow peter Frampton la lleva, es un grande de la musica. Me gustaria mucho verlo en vivo ^^ saludos HN

  30. juan Angulo says:

    excelente quiero irrrr

  31. Ivan says:

    Yooooo quieroo para regalar!! mi vieja es fanatica de Frampton y esta de cumple hoy!! ojala sean dos para que vaya con mi viejo 😀

  32. Joaquín Cruzat Palacios says:

    Yo quiero una porfavor!!!!

  33. Daniel Neira Bravo says:

    A ver si me gano esta entrada…

  34. Eduardo Díaz Fredes says:

    Esta vez si que me las gano!!!

  35. Claudio Hidalgo Neira says:

    grande Peter Frampton! ojalá pueda ir a ver al maestro!

  36. Miguel Caroca says:

    Tremendo artista, ahora solo se podra apreciar mejor su calidad musical, saludos y gracias por el concurso

  37. cristian blas says:

    Los años no pasan y Peter Frampton nos mostrara el camino del rock, este año no da para mas pero gracias por el concurso, un auspicio para asistir es necesario
    suerte a todos

  38. jose molina says:

    Chiquillos quiero ir con mi vieja!!!!!! esta de cumple justyo ese dia
    plis!

  39. Sebastián Valenzuela says:

    A ver si alguna vez gano algo en la vida! Aguante Frampton! Cuaaaaaa… cuacuaucacuacuaaaaaaaaa!!

  40. matias says:

    vamos a por una

  41. Carla says:

    Definitivamente quiero ir.. aparte.. sería genial invitar a mi papa a verlo.. pq hay q agradecer a quienes nos inculcaron la buena música =D

  42. pablo carrasco says:

    Me encantaría ir a escuchar a Frampton! un clásico, un grande, un ídolo. Si no me gano una entrada, no habrá otra posibilidad de ir, así de lapidario.

  43. luis felipe palma guerrero says:

    una entarda aqui pos amigos de humo negro
    que el bolsillo ya no aguanta =)))

  44. Guillermo Pereira M. says:

    Yo quiero unaaaaaaaaaaa!!!!!!!!!!!!!!!! 🙂

  45. Diego San Martín says:

    Vamos que me gano una !!!!! :D:D:D
    ya que no fui a viña acá por ultimo hahaha saludos!

  46. Mauricio Prado says:

    yo quiero pa ir con mi viejo !

  47. 46 años y Peter es de mi epoca

  48. FERNANDO CARRASCO SANCHEZ says:

    SOY DE LA EPOCA DE PETER , TENGO 46Y QUIERO GANARME LAS 2 ENTRADAS PARA IR CON MI SEÑORA, SI QUIERE ACOMPAÑARME

    FCS
    08-5619524

  49. sebastian flores palma says:

    meresco la oportunidad de ver al maestro frampton necesito ese ticket

  50. Dominique Ravet says:

    quiero ganarme la entrada porfaaa!! osino me quedo sin ir a niun concierto de este año =(

  51. Mas que merecerme “yo” esaq entrada la verdad es que lo hago por mi viejo. rockero a cagar en los 70’siempre se ha sacado la mierda por nosotros y gracias a el y todo su esfuerzo es que me encuentro estudiando. dinero no tengo niuno como para poder regalarle una entrada. y como es de terco jamas se comprara una ya que las lucas no sobran, al contrario, ademas que se encuentra preocupadisimo por un drama que tengo en el instituto. y eso
    espero ser el afortunado, bueno. mas que yo, mi viejo. y puta si no es asi no importa. ojala si la gane alguien que de verdad se lo meresca.

    saludos Humo Negro!

  52. lo olvidaba. mail valido de contacto porsi ifelman@hotmail.com

  53. josé alvear says:

    De chico fue el primer disco en vivode rock que escuché junto con el de Neil Diamond. Feliz iría

  54. Alejandro Arístegui says:

    Sería el regalo perfecto para mi viejo.
    Saludos

  55. Matías Infante Brunet says:

    Simplemente un gran guitarrista con unas excelentes canciones, que mejor escuchar algo de Humblepie (stone cold fever) o solista (lines on my face).

    Ojala pueda corear el Do you feel like we do!!!

  56. ana cautivo says:

    yo tambien kiero ir, me trae recuerdos aquellos temas

  57. Sebastián Castillo says:

    yo quierooooo, me fui a perdida y no tengo ni uno para los conciertos que vienen T.T

  58. Marcelo Moya says:

    Show me some tickets!

  59. Sebastián Geiger Prat says:

    Tremendo guitarrista! Humo negro… entralizame!

  60. Same Sapag says:

    Grande Humo Negro, siempre se agradecen estos sorteos.

  61. Luciano Silva says:

    Que grande Frampton. Ojalá me gane las entraditas ya que me lo gaste todo en los demas grandes conciertos que vienen

  62. Pablo Ignacio Muñoz Vallejos says:

    Yo quiero una entrada, Grande Peter

  63. Solange Ramirez says:

    me encantaría ganarme una entradita 😛 grande Framptom

  64. Abel Silva says:

    Excelente!
    un artista de peso, que ha mantenido su calidad musical a pesar del largo paso de los años

    una entradita por aqui!!!

  65. valeria muñoz says:

    que guachon se ve asi de viejo peter frampton…como no ir a verlo ademas que su musica es increible ojala me gane una entrada!!

  66. Juan Avalos Martinez says:

    simplemente un idolo del rock

  67. Ignacio Larrain says:

    Grande Peter!

  68. Jose Landabur says:

    Como no verlo si el mismo dice que esta en sus mejores tiempos!

  69. eric martinez says:

    Quiero iiiiiiiiiiiiiiiiiiiiiir¡¡¡¡¡¡¡¡¡¡¡¡
    Especial para compartir una noche de buena musica junto a mi viejo.
    grande framptom…………….

  70. Eduardo Vergara says:

    Quierooo iiir !!!
    Tremendo musico !

  71. Excelente Peter Frampton, quiero una entrada please!!

  72. Hugo González Peters says:

    HumoNegro: Show Me The way!

  73. Rene Sottolichio R. says:

    Tremendo clásico, ojala me gane entradas.
    Saludos!

  74. Lino Pastene says:

    Porfa una entrada para mi, septiembre y octubre viene salado.

  75. cRISTIAN gONZALEZ rIFFO says:

    cuando dice “tenemos invitaciones” deberian ser sus 10 de una y no menos..

    anotenme condenaos!..
    jee
    gracias..

Comentar

Responder